Быстрый заказ

Text Size:AAA

Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MDGA2 Информация о продукте «Клон cDNA»
Размер кДНК:2871bp
Описание кДНК:Full length Clone DNA of Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 with N terminal His tag.
Синоним гена:MAMDC1, c14_5286, MDGA2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11372-ACGRBS22240
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11372-ACRRBS22240
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11372-CFRBS20190
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11372-CHRBS20190
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11372-CMRBS20190
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11372-CYRBS20190
Человек MDGA2 Джин клон кДНК в вектор клонированияHG11372-MRBS5130
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11372-NFRBS20190
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11372-NHRBS20190
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11372-NMRBS20190
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11372-NYRBS20190
Человек MDGA2 Джин ORF экспрессии кДНК клона плазмидыHG11372-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mouse MAM domain-containing glycosylphosphatidylinositol anchor protein 2, also known as MAM domain-containing protein 1, MDGA2 and MAMDC1, is a cell membrane protein which contains six Ig-like (immunoglobulin-like) domains and one MAM domain. Analyses of the full-length coding region of MDGA1 and MDGA2 indicate that they encode proteins that comprise a novel subgroup of the Ig superfamily and have a unique structural organization consisting of six immunoglobulin (Ig)-like domains followed by a single MAM domain. Biochemical characterization demonstrates that MDGA1 and MDGA2 proteins are highly glycosylated, and that MDGA1 is tethered to the cell membrane by a GPI anchor. The MDGAs are differentially expressed by subpopulations of neurons in both the central and peripheral nervous systems, including neurons of the basilar pons, inferior olive, cerebellum, cerebral cortex, olfactory bulb, spinal cord, and dorsal root and trigeminal ganglia. The similarity of MDGAs to other Ig-containing molecules and their temporal-spatial patterns of expression within restricted neuronal populations, for example migrating pontine neurons and D1 spinal interneurons, suggest a role for these novel proteins in regulating neuronal migration, as well as other aspects of neural development, including axon guidance.

  • Litwack,ED. et al., 2004, Mol Cell Neurosci. 25 (2): 263-74.
  • Hellquist, A. et al., 2009, PLoS One. 4 (12): e8037.
  • Sano,S. et al., 2009, Genesis. 47 (8):505-13.
  • Bucan, M. et al., 2009, PLoS Genet. 5 (6):e1000536.
  • Size / Price
    Каталог: HG11372-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.