Быстрый заказ

Человек MDFI Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек MDFI Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC007836
    Размер кДНК:741bp
    Описание кДНК:Full length Clone DNA of Homo sapiens MyoD family inhibitor.
    Синоним гена:RP4-696P19.1, I-MF, I-mfa, MDFI
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MDFI qPCR primers for gene expression analysis, HP102898 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14248-ACGRBS15400
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14248-ACRRBS15400
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14248-ANGRBS15400
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14248-ANRRBS15400
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14248-CFRBS13340
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14248-CHRBS13340
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14248-CMRBS13340
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14248-CYRBS13340
    Человек MDFI Джин клон кДНК в вектор клонированияHG14248-GRBS5130
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14248-NFRBS13340
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14248-NHRBS13340
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14248-NMRBS13340
    Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14248-NYRBS13340
    Человек MDFI Джин ORF экспрессии кДНК клона плазмидыHG14248-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14248-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».