After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MDFI Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MDFI Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC007836
Размер кДНК:741bp
Описание кДНК:Full length Clone DNA of Homo sapiens MyoD family inhibitor.
Синоним гена:RP4-696P19.1, I-MF, I-mfa, MDFI
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14248-ACGRBS15400
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14248-ACRRBS15400
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14248-ANGRBS15400
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14248-ANRRBS15400
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14248-CFRBS13340
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14248-CHRBS13340
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14248-CMRBS13340
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14248-CYRBS13340
Человек MDFI Джин клон кДНК в вектор клонированияHG14248-GRBS5130
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14248-NFRBS13340
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14248-NHRBS13340
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14248-NMRBS13340
Человек MDFI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14248-NYRBS13340
Человек MDFI Джин ORF экспрессии кДНК клона плазмидыHG14248-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14248-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».