After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CSF1R Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005211.3
Размер кДНК:2919bp
Описание кДНК:Full length Clone DNA of Homo sapiens colony stimulating factor 1receptor (CSF1R) with N terminal Myc tag.
Синоним гена:C-FMS, CD115, CSFR, FIM2, FMS
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10161-ACGRBS22240
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10161-ACRRBS22240
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10161-CFRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10161-CHRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10161-CMRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10161-CYRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин клон кДНК в вектор клонированияHG10161-MRBS5130
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10161-M-FRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10161-NFRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10161-NHRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10161-NMRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10161-NYRBS20190
Человек MCSF Receptor/CSF1R/CD115 Джин ORF экспрессии кДНК клона плазмидыHG10161-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved in the proliferation, differentiation, and activation of macrophages. This cell surface glycoprotein is consisted by an extracellular ligand-binding domain, a single membrane-spanning segment, and an intracellular tyrosine kinase domain. Binding of CSF1 activates the receptor kinase, leading to "autophosphorylation" of receptor subunits and the concomitant phosphorylation of a series of cellular proteins on tyrosine residues. CSF1R is a tyrosine kinase receptor that is absolutely required for macrophage differentiation and thus occupies a central role in hematopoiesis. CSF1 and its receptor (CSF1R, product of c-fms proto-oncogene) were initially implicated as essential for normal monocyte development as well as for trophoblastic implantation. This apparent role for CSF1/CSF1R in normal mammary gland development is very intriguing because this receptor/ligand pair has also been found to be important in the biology of breast cancer in which abnormal expression of CSF1 and its receptor correlates with tumor cell invasiveness and adverse clinical prognosis. Tumor cell expression of CSF1R is under the control of several steroid hormones (glucocorticoids and progestins) and the binding of several bHLH transcription factors, while tumor cell expression of CSF-1 appears to be regulated by other hormones, some of which are involved in normal lactogenic differentiation. However, studies have demonstrated that CSF1 and CSF1R have additional roles in mammary gland development during pregnancy and lactation. The role of CSF1 and CSF1R in normal and neoplastic mammary development that may elucidate potential relationships of growth factor-induced biological changes in the breast during pregnancy and tumor progression.

Ссылки
  • Sherr CJ. (1990) The colony-stimulating factor 1 receptor: pleiotropy of signal-response coupling. Lymphokine Res. 9(4): 543-8.
  • Kacinski BM. (1997) CSF-1 and its receptor in breast carcinomas and neoplasms of the female reproductive tract. Mol Reprod Dev. 46(1): 71-4.
  • Sapi E, et al. (1999) The role of CSF-1 in normal and neoplastic breast physiology. Proc Soc Exp Biol Med. 220(1): 1-8.
  • Sapi E. (2004) The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood). 229(1): 1-11.
  • Bonifer C, et al. (2008) The transcriptional regulation of the Colony-Stimulating Factor 1 Receptor (csf1r) gene during hematopoiesis. Front Biosci. 13: 549-60.
  • Size / Price
    Каталог: HG10161-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».