Быстрый заказ

Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

  • Human MDM2 Gene Plasmid Map 5775
ПаспортОбзорыСвязанные продуктыПротоколы
Человек MCM6 Информация о продукте «Клон cDNA»
Размер кДНК:2511 bp
Описание кДНК:Full length Clone DNA of Homo sapiens minichromosome maintenance complex component 6 with N terminal Myc tag.
Синоним гена:MCG40308, Mis5, P105MCM, MCM6
Участок рестрикции:KpnI + NotI(6kb+2.51kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with MCM6 qPCR primers for gene expression analysis, HP102967 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14317-ACGRBS16760
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14317-ACRRBS16760
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14317-ANGRBS16760
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14317-ANRRBS16760
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14317-CFRBS14710
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14317-CHRBS14710
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14317-CMRBS14710
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14317-CYRBS14710
Человек MCM6 Джин клон кДНК в вектор клонированияHG14317-GRBS5130
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14317-NFRBS14710
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14317-NHRBS14710
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14317-NMRBS14710
Человек MCM6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14317-NYRBS14710
Человек MCM6 Джин ORF экспрессии кДНК клона плазмидыHG14317-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14317-NM
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.