After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MAVS Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MAVS Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC044952
Размер кДНК:1623bp
Описание кДНК:Full length Clone DNA of Homo sapiens mitochondrial antiviral signaling protein DNA.
Синоним гена:IPS1, VISA, IPS-1, CARDIF
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15224-ACGRBS16760
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15224-ACRRBS16760
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15224-ANGRBS16760
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15224-ANRRBS16760
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15224-CFRBS14710
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15224-CHRBS14710
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15224-CMRBS14710
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15224-CYRBS14710
Человек MAVS Джин клон кДНК в вектор клонированияHG15224-GRBS5130
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15224-NFRBS14710
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15224-NHRBS14710
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15224-NMRBS14710
Человек MAVS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15224-NYRBS14710
Человек MAVS Джин ORF экспрессии кДНК клона плазмидыHG15224-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15224-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».