Быстрый заказ

Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MASTL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032844.2
Размер кДНК:2637bp
Описание кДНК:Full length Clone DNA of Homo sapiens microtubule associated serine/threonine kinase-like with N terminal His tag.
Синоним гена:THC2, FLJ14813, RP11-85G18.2, MASTL
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10761-ACGRBS22240
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10761-ACRRBS22240
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10761-ANGRBS22240
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10761-ANRRBS22240
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10761-CFRBS20190
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10761-CHRBS20190
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10761-CMRBS20190
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10761-CYRBS20190
Человек MASTL/THC2 Джин клон кДНК в вектор клонированияHG10761-MRBS5130
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10761-M-FRBS20190
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10761-NFRBS20190
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10761-NHRBS20190
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10761-NMRBS20190
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10761-NYRBS20190
Человек MASTL/THC2 Джин ORF экспрессии кДНК клона плазмидыHG10761-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10761-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».