JNK1 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

JNK1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1284 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

JNK1 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

JNK cDNA ORF Clone, Human; JNK-46 cDNA ORF Clone, Human; JNK1 cDNA ORF Clone, Human; JNK1A2 cDNA ORF Clone, Human; JNK21B1/2 cDNA ORF Clone, Human; PRKM8 cDNA ORF Clone, Human; SAPK1 cDNA ORF Clone, Human; SAPK1c cDNA ORF Clone, Human

JNK1 Background Information

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.
Full Name
mitogen-activated protein kinase 8
Research Areas
References
  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait