After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MAPK8 Информация о продукте «Клон cDNA»
Размер кДНК:1284bp
Описание кДНК:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal Myc tag.
Синоним гена:JNK, JNK1, PRKM8, SAPK1, JNK1A2, JNK21B1/2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10795-ACGRBS15400
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10795-ACRRBS15400
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10795-ANGRBS15400
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10795-ANRRBS15400
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10795-CFRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10795-CHRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10795-CMRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10795-CYRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин клон кДНК в вектор клонированияHG10795-MRBS5130
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10795-M-FRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмидыHG10795-M-NRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10795-NFRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10795-NHRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10795-NMRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10795-NYRBS13340
Человек JNK1 / MAPK8 transcript variant JNK1-b2 Джин ORF экспрессии кДНК клона плазмидыHG10795-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
  • Size / Price
    Каталог: HG10795-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.