After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MAPK13 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002754.3
Размер кДНК:1098bp
Описание кДНК:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 13 with N terminal His tag.
Синоним гена:SAPK4, PRKM13, MGC99536, p38delta, MAPK13
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10747-ACGRBS15400
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10747-ACRRBS15400
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10747-ANGRBS15400
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10747-ANRRBS15400
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10747-CFRBS13340
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10747-CHRBS13340
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10747-CMRBS13340
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10747-CYRBS13340
Человек p38 delta/MAPK13 Джин клон кДНК в вектор клонированияHG10747-MRBS5130
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10747-M-FRBS13340
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10747-NFRBS13340
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10747-NHRBS13340
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10747-NMRBS13340
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10747-NYRBS13340
Человек p38 delta/MAPK13 Джин ORF экспрессии кДНК клона плазмидыHG10747-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The p38 family of mitogen-activated protein kinases (MAPK) includes p38 alpha (SAPK2a, CSBP), p38 beta (SAPK2b), p38 delta (SAPK4), and p38 gamma (SAPK3/ERK6). p38 alpha and p38 beta are widely expressed p38 isoforms that are involved in regulation of cell proliferation, differentiation, development, and response to stress. p38 delta, also known as MAPK13, is a regulator of differentiation-dependent gene expression in keratinocytes, and been as a regulator of surface epithelia differentiation and apoptosis. p38 delta protein is upregulated in Cholangiocarcinoma (CC) relative to hepatocellularcarcinoma (HCC) and to normal biliary tract tissues. p38 delta is important for motility and invasion of CC cells, suggesting that p38 delta may play an important role in CC metastasis. p38 delta is expressed in the epidermis, suggesting a role for p38 delta in regulating differentiation. p38 delta is the major p38 isoform driving suprabasal involucrin gene expression and that p38 delta directly regulates ERK1/2 activity via formation of a p38 delta-ERK1/2 complex. Recent emerging evidence suggests that the p38 stress MAPK pathway may function as a tumor suppressor through regulating Ras-dependent and -independent proliferation, transformation, invasion and cell death by isoform-specific mechanisms. p38 delta has important role in promoting cell proliferation and tumor development in epidermis and may have therapeutic implication for skin cancer.

Ссылки
  • Efimova T, et al. (2003) A regulatory role for p38 delta MAPK in keratinocyte differentiation. Evidence for p38 delta-ERK1/2 complex formation. J Biol Chem. 278(36): 34277-85.
  • Eckert RL, et al. (2003) p38 Mitogen-activated protein kinases on the body surface--a function for p38 delta. J Invest Dermatol. 120(5): 823-8.
  • Loesch M, et al. (2008) The p38 MAPK stress pathway as a tumor suppressor or more? Front Biosci. 13: 3581-93.
  • Schindler EM, et al. (2009) p38delta Mitogen-activated protein kinase is essential for skin tumor development in mice. Cancer Res. 69(11): 4648-55.
  • Tan FL, et al. (2010) p38delta/MAPK13 as a diagnostic marker for cholangiocarcinoma and its involvement in cell motility and invasion. Int J Cancer. 126(10): 2353-61.
  • Size / Price
    Каталог: HG10747-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».