Быстрый заказ

Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MAP3K8 Информация о продукте «Клон cDNA»
Размер кДНК:1404bp
Описание кДНК:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase kinase 8 with N terminal Myc tag.
Синоним гена:COT, EST, ESTF, TPL2, Tpl-2, c-COT, FLJ10486
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10800-ACGRBS15400
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10800-ACRRBS15400
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10800-ANGRBS15400
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10800-ANRRBS15400
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10800-CFRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10800-CHRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10800-CMRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10800-CYRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин клон кДНК в вектор клонированияHG10800-MRBS5130
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10800-M-HRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10800-NFRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10800-NHRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10800-NMRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10800-NYRBS13340
Человек TPL2/MAP3K8/MEKK8 Джин ORF экспрессии кДНК клона плазмидыHG10800-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • Size / Price
    Каталог: HG10800-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.