After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MAP1LC3A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC015810
Размер кДНК:366bp
Описание кДНК:Full length Clone DNA of Homo sapiens microtubule-associated protein 1 light chain 3 alpha with N terminal Myc tag.
Синоним гена:RP11-346K17.1, ATG8E, LC3, LC3A, MAP1ALC3, MAP1BLC3, MAP1LC3A
Виды:Human
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14322-ACGRBS15400
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14322-ACRRBS15400
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14322-ANGRBS15400
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14322-ANRRBS15400
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14322-CFRBS13340
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14322-CHRBS13340
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14322-CMRBS13340
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14322-CYRBS13340
Человек LC3A/MAP1LC3A Джин клон кДНК в вектор клонированияHG14322-GRBS5130
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14322-NFRBS13340
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14322-NHRBS13340
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14322-NMRBS13340
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14322-NYRBS13340
Человек LC3A/MAP1LC3A Джин ORF экспрессии кДНК клона плазмидыHG14322-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

LC3A, also known as MAP1LC3A, is one of the light chain subunits that functions together with both MAP1A and/or MAP1B. MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. As a light chain subunit, MAP1LC3A has an important part in neuronal development and in maintaining the balance between neuronal plasticity and rigidity. MAP1LC3A is expressed as two alternatively spliced isoforms that are expressed in testis, brain, heart, liver and skeletal muscle, but are absent in thymus and peripheral blood leukocytes.

Size / Price
Каталог: HG14322-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».