Быстрый заказ

Text Size:AAA

Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MAOA Информация о продукте «Клон cDNA»
Размер кДНК:1584bp
Описание кДНК:Full length Clone DNA of Homo sapiens monoamine oxidase A with C terminal His tag.
Синоним гена:MAOA
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12051-ACGRBS16760
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12051-ACRRBS16760
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12051-ANGRBS16760
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12051-ANRRBS16760
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12051-CFRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12051-CHRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12051-CMRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12051-CYRBS14710
Человек MAOA Джин клон кДНК в вектор клонированияHG12051-GRBS5130
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12051-NFRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12051-NHRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12051-NMRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12051-NYRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмидыHG12051-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Huang SY, et al. (2009) Association of monoamine oxidase A (MAOA) polymorphisms and clinical subgroups of major depressive disorders in the Han Chinese population. World J Biol Psychiatry. 10 (4): 544-51.
  • Guo G, et al. (2008) The VNTR 2 repeat in MAOA and delinquent behavior in adolescence and young adulthood: associations and MAOA promoter activity. Eur J Hum Genet. 16(5): 626-34
  • McDermott R, et al. (2009) Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation. Proc Natl Acad Sci. 106 (7): 2118-23.
  • Size / Price
    Каталог: HG12051-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.