After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MAOA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000240
Размер кДНК:1584bp
Описание кДНК:Full length Clone DNA of Homo sapiens monoamine oxidase A with C terminal His tag.
Синоним гена:MAOA
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12051-ACGRBS16760
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12051-ACRRBS16760
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12051-ANGRBS16760
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12051-ANRRBS16760
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12051-CFRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12051-CHRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12051-CMRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12051-CYRBS14710
Человек MAOA Джин клон кДНК в вектор клонированияHG12051-GRBS5130
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12051-NFRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12051-NHRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12051-NMRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12051-NYRBS14710
Человек MAOA Джин ORF экспрессии кДНК клона плазмидыHG12051-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Huang SY, et al. (2009) Association of monoamine oxidase A (MAOA) polymorphisms and clinical subgroups of major depressive disorders in the Han Chinese population. World J Biol Psychiatry. 10 (4): 544-51.
  • Guo G, et al. (2008) The VNTR 2 repeat in MAOA and delinquent behavior in adolescence and young adulthood: associations and MAOA promoter activity. Eur J Hum Genet. 16(5): 626-34
  • McDermott R, et al. (2009) Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation. Proc Natl Acad Sci. 106 (7): 2118-23.
  • Size / Price
    Каталог: HG12051-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».