Быстрый заказ

Text Size:AAA

Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EPM2A Информация о продукте «Клон cDNA»
Размер кДНК:996bp
Описание кДНК:Full length Clone DNA of Homo sapiens epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) with N terminal His tag.
Синоним гена:EPM2, MELF, EPM2A
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10749-ACGRBS15400
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10749-ACRRBS15400
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10749-ANGRBS15400
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10749-ANRRBS15400
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10749-CFRBS13340
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10749-CHRBS13340
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10749-CMRBS13340
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10749-CYRBS13340
Человек Laforin/EPM2A Джин клон кДНК в вектор клонированияHG10749-MRBS5130
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10749-NFRBS13340
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10749-NHRBS13340
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10749-NMRBS13340
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10749-NYRBS13340
Человек Laforin/EPM2A Джин ORF экспрессии кДНК клона плазмидыHG10749-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10749-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.