After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LYZL2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC066294
Размер кДНК:585bp
Описание кДНК:Full length Clone DNA of Homo sapiens lysozyme-like 2 with N terminal Myc tag.
Синоним гена:LYZL2
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13726-ACGRBS15400
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13726-ACRRBS15400
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13726-CFRBS13340
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13726-CHRBS13340
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13726-CMRBS13340
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13726-CYRBS13340
Человек Lysozyme 2 / LYZL2 Джин клон кДНК в вектор клонированияHG13726-GRBS5130
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13726-NFRBS13340
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13726-NHRBS13340
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13726-NMRBS13340
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13726-NYRBS13340
Человек Lysozyme 2 / LYZL2 Джин ORF экспрессии кДНК клона плазмидыHG13726-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Lysozyme 2 gene is a member of a family of lysozyme-like genes. Lysozymes, especially C-type lysozymes, are well-recognized bacteriolytic factors widely distributed in the animal kingdom and play a mainly protective role in host defense. Lysozymes damage bacterial cell walls by catalyzing hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrins.

Lysozyme is part of the innate immune system. Reduced lysozyme levels have been associated with bronchopulmonary dysplasia in newborns. In certain cancers (especially myelomonocytic leukemia) excessive production of lysozyme by cancer cells can lead to toxic levels of lysozyme in the blood. High lysozyme blood levels can lead to kidney failure and low blood potassium, conditions that may improve or resolve with treatment of the primary malignancy.

Ссылки
  • Lamesch P. et al., 2007, Genomics. 89 (3): 307-15.
  • Argyropoulos G. et al., 2009, Physiol Genomics. 36 (2): 79-88.
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Size / Price
    Каталог: HG13726-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».