After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human LYPD1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC017318
Размер кДНК:426bp
Описание кДНК:Full length Clone DNA of Homo sapiens LY6/PLAUR domain containing 1.
Синоним гена:PHTS, LYPDC1, LYPD1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13296-ACGRBS15400
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13296-ACRRBS15400
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13296-CFRBS13340
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13296-CHRBS13340
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13296-CMRBS13340
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13296-CYRBS13340
Человек LYPD1 Джин клон кДНК в вектор клонированияHG13296-GRBS5130
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13296-NFRBS13340
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13296-NHRBS13340
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13296-NMRBS13340
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13296-NYRBS13340
Человек LYPD1 Джин ORF экспрессии кДНК клона плазмидыHG13296-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13296-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».