After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human LSM7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC018621
Размер кДНК:312bp
Описание кДНК:Full length Clone DNA of Homo sapiens LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) DNA.
Синоним гена:YNL147W
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15232-ACGRBS15400
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15232-ACRRBS15400
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15232-ANGRBS15400
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15232-ANRRBS15400
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15232-CFRBS13340
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15232-CHRBS13340
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15232-CMRBS13340
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15232-CYRBS13340
Человек LSM7 Джин клон кДНК в вектор клонированияHG15232-GRBS5130
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15232-NFRBS13340
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15232-NHRBS13340
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15232-NMRBS13340
Человек LSM7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15232-NYRBS13340
Человек LSM7 Джин ORF экспрессии кДНК клона плазмидыHG15232-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15232-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».