LSM6 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

LSM6 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
243 bp
Description
Full length Clone DNA of Human LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LSM6 cDNA ORF Clone, Human, C-His tag: Alternative Names

YDR378C cDNA ORF Clone, Human

LSM6 Background Information

Full Name
LSM6 homolog, U6 small nuclear RNA and mRNA degradation associated
Add to Cart Successfully Add to Cart Failed