LSM6 cDNA ORF Clone, Human, C-His tag

Cat: HG13995-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LSM6 Reagents
CRO Services
Product recommended

All LSM6 Reagents
LSM6 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
243 bp
Description
Full length Clone DNA of Human LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LSM6 cDNA ORF Clone, Human, C-His tag Alternative Names
YDR378C cDNA ORF Clone, Human
LSM6 Background Information
Full Name
LSM6 homolog, U6 small nuclear RNA and mRNA degradation associated

LSM6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LSM6 cDNA ORF Clone in Cloning Vector, Mouse MG5A6786-U
LSM6 cDNA ORF Clone, Mouse, untagged MG5A6786-UT
LSM6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6786-ACGLN
LSM6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6786-ACG
LSM6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6786-ANG
LSM6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6786-ACR
LSM6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6786-ANR
LSM6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6786-CF
LSM6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6786-NF
LSM6 cDNA ORF Clone, Mouse, C-His tag MG5A6786-CH
LSM6 cDNA ORF Clone, Mouse, N-His tag MG5A6786-NH
LSM6 cDNA ORF Clone, Mouse, C-HA tag MG5A6786-CY
LSM6 cDNA ORF Clone, Mouse, N-HA tag MG5A6786-NY
LSM6 cDNA ORF Clone, Mouse, C-Myc tag MG5A6786-CM
LSM6 cDNA ORF Clone, Mouse, N-Myc tag MG5A6786-NM

LSM6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LSM6 cDNA ORF Clone in Cloning Vector, Human HG13995-G
LSM6 cDNA ORF Clone, Human, untagged HG13995-UT
LSM6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13995-ACGLN
LSM6 cDNA ORF Clone, Human, C-GFPSpark® tag HG13995-ACG
LSM6 cDNA ORF Clone, Human, N-GFPSpark® tag HG13995-ANG
LSM6 cDNA ORF Clone, Human, C-OFPSpark® tag HG13995-ACR
LSM6 cDNA ORF Clone, Human, N-OFPSpark® tag HG13995-ANR
LSM6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13995-CF
LSM6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13995-NF
LSM6 cDNA ORF Clone, Human, N-His tag HG13995-NH
LSM6 cDNA ORF Clone, Human, C-HA tag HG13995-CY
LSM6 cDNA ORF Clone, Human, N-HA tag HG13995-NY
LSM6 cDNA ORF Clone, Human, C-Myc tag HG13995-CM
LSM6 cDNA ORF Clone, Human, N-Myc tag HG13995-NM
LSM6 qPCR Primer Pairs, Human HP102651
info info
添加购物车成功! 添加购物车失败!