LSM3 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

LSM3 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
309 bp
Description
Full length Clone DNA of Human LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LSM3 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

SMX4 cDNA ORF Clone, Human; USS2 cDNA ORF Clone, Human; YLR438C cDNA ORF Clone, Human

LSM3 Background Information

LSM3 is a member of the snRNP Sm proteins family. Sm-like proteins can be detected in a variety of organisms. They all have the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM3binds specifically to the 3'-terminal U-tract of U6 snRNA.
Full Name
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
References
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Lehner B. et al., 2004, Genome Res. 14 (7): 1315-23.
  • Lehner B. et al., 2004, Genomics. 83 (1): 153-67.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait