Быстрый заказ

Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек LSM1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC001767
    Размер кДНК:402bp
    Описание кДНК:Full length Clone DNA of Homo sapiens LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) with C terminal Myc tag.
    Синоним гена:CASM, YJL124C, LSM1
    Виды:Human
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LSM1 qPCR primers for gene expression analysis, HP102794 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14142-ACGRBS15400
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14142-ACRRBS15400
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14142-ANGRBS15400
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14142-ANRRBS15400
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14142-CFRBS13340
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14142-CHRBS13340
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14142-CMRBS13340
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14142-CYRBS13340
    Человек LSM1 Джин клон кДНК в вектор клонированияHG14142-GRBS5130
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14142-NFRBS13340
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14142-NHRBS13340
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14142-NMRBS13340
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14142-NYRBS13340
    Человек LSM1 Джин ORF экспрессии кДНК клона плазмидыHG14142-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    LSM1 is a Sm-like protein. Sm-like proteins can be detected in a variety of organisms based on sequence homology with the Sm protein family. Sm-like proteins include the Sm sequence motif, which consists of two regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM1 has a role in replication-dependent histone mRNA degradation and binds specifically to the 3''-terminal U-tract of U6 snRNA. LSM1 also facilitates RNA protein interactions and structural modifications which are required during ribosomal subunit assembly.

    Ссылки
  • Shimizu Y, et al. (1997) Lineage- and differentiation stage-specific expression of LSM-1 (LPAP), a possible substrate for CD45, in human hematopoietic cells. Am J Hematol. 54(1):1=11.
  • Graber MW, et al. (1997) CaSm: an Sm-like protein that contributes to the transformed state in cancer cells. Cancer Res. 57(14):2961-5.
  • Séraphin B, et al. (1999) Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin. EMBO J. 18(12):3451-62.
  • Size / Price
    Каталог: HG14142-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».