Быстрый заказ

Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек LRRTM4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001134745.1
    Размер кДНК:1773bp
    Описание кДНК:Full length Clone DNA of Homo sapiens leucine rich repeat transmembrane neuronal 4 with N terminal His tag.
    Синоним гена:FLJ12568, MGC120633, MGC120636, LRRTM4
    Виды:Human
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LRRTM4 qPCR primers for gene expression analysis, HP101265 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11387-ACGRBS16760
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11387-ACRRBS16760
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11387-CFRBS14710
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11387-CHRBS14710
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11387-CMRBS14710
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11387-CYRBS14710
    Человек LRRTM4 Джин клон кДНК в вектор клонированияHG11387-MRBS5130
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11387-NFRBS14710
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11387-NHRBS14710
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11387-NMRBS14710
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11387-NYRBS14710
    Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмидыHG11387-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Leucine-rich repeat transmembrane neuronal protein 4, also known as LRRTM4, is a single-pass type I  membrane protein which belongs to the LRRTM family. LRRTM4 is expressed in the limb mesenchyme, neural tube, caudal mesoderm and in three distinct regions of the head. LRRTM4 may play a role in the development and maintenance of the vertebrate nervous system. Leucine-rich repeat containing proteins are involved in protein-protein interactions and they regulate numerous cellular events during nervous system development and disease. Human and mouse LRRTMs are highly conserved, and orthologous genes exist in other vertebrates but not in invertebrates. LRRTM mRNAs are predominantly expressed in the nervous system and that each LRRTM possesses a specific, partially nonoverlapping expression pattern. The structure and expression profile of LRRTM mRNAs suggest that they may have a role in the development and maintenance of the vertebrate nervous system. All LRRTMs, except LRRTM4, are located in the introns of different alpha-catenin genes, suggesting coevolution of these two gene families.

    Ссылки
  • Laurén,J. et al., 2003, Genomics 81 (4):411-21.
  • Clark HF. et al.,2003, Genome Res. 13: 2265-70.
  • Haines,BP. et al., 2007,Gene Expr Patterns  7 (1-2): 23-9.
  • Size / Price
    Каталог: HG11387-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».