After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LRRTM4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001134745.1
Размер кДНК:1773bp
Описание кДНК:Full length Clone DNA of Homo sapiens leucine rich repeat transmembrane neuronal 4 with N terminal His tag.
Синоним гена:FLJ12568, MGC120633, MGC120636, LRRTM4
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11387-ACGRBS16760
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11387-ACRRBS16760
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11387-CFRBS14710
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11387-CHRBS14710
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11387-CMRBS14710
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11387-CYRBS14710
Человек LRRTM4 Джин клон кДНК в вектор клонированияHG11387-MRBS5130
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11387-NFRBS14710
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11387-NHRBS14710
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11387-NMRBS14710
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11387-NYRBS14710
Человек LRRTM4 Джин ORF экспрессии кДНК клона плазмидыHG11387-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Leucine-rich repeat transmembrane neuronal protein 4, also known as LRRTM4, is a single-pass type I  membrane protein which belongs to the LRRTM family. LRRTM4 is expressed in the limb mesenchyme, neural tube, caudal mesoderm and in three distinct regions of the head. LRRTM4 may play a role in the development and maintenance of the vertebrate nervous system. Leucine-rich repeat containing proteins are involved in protein-protein interactions and they regulate numerous cellular events during nervous system development and disease. Human and mouse LRRTMs are highly conserved, and orthologous genes exist in other vertebrates but not in invertebrates. LRRTM mRNAs are predominantly expressed in the nervous system and that each LRRTM possesses a specific, partially nonoverlapping expression pattern. The structure and expression profile of LRRTM mRNAs suggest that they may have a role in the development and maintenance of the vertebrate nervous system. All LRRTMs, except LRRTM4, are located in the introns of different alpha-catenin genes, suggesting coevolution of these two gene families.

Ссылки
  • Laurén,J. et al., 2003, Genomics 81 (4):411-21.
  • Clark HF. et al.,2003, Genome Res. 13: 2265-70.
  • Haines,BP. et al., 2007,Gene Expr Patterns  7 (1-2): 23-9.
  • Size / Price
    Каталог: HG11387-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».