LRRC3B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

LRRC3B cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
780 bp
Description
Full length Clone DNA of Human leucine rich repeat containing 3B with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LRRC3B cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

LRP15 cDNA ORF Clone, Human

LRRC3B Background Information

LRRC3B expression is downregulated in many kinds of malignant tumors and it is regarded as tumor inhibition protein. The leucine rich repeat containing 3B (LRRC3B) gene is a putative tumor suppressor located on human chromosome 3 in the 3p24 region. LRRC3B is frequently altered in colon and gastric cancers and also in leukaemias.LRRC3B expression downreguated in lung cancer cell lines and LRRC3B could inhibit lung cancer cell proliferation, invasion and cell cycle progress. LRRC3B could be a new target for lung cancer therapy.LRRC3B depletion in HBE cells promoted proliferation and invasion,suggesting that LRRC3B may serve as an important tumor suppressor in NSCLC.
Full Name
leucine rich repeat containing 3B
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait