After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LRG1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC034389
Размер кДНК:1044bp
Описание кДНК:Full length Clone DNA of Homo sapiens leucine-rich alpha-2-glycoprotein 1 with N terminal Flag tag.
Синоним гена:LRG, HMFT1766, LRG1
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13371-ACGRBS15400
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13371-ACRRBS15400
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13371-CFRBS13340
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13371-CHRBS13340
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13371-CMRBS13340
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13371-CYRBS13340
Человек LRG1 Джин клон кДНК в вектор клонированияHG13371-GRBS5130
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13371-G-HRBS13340
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13371-NFRBS13340
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13371-NHRBS13340
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13371-NMRBS13340
Человек LRG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13371-NYRBS13340
Человек LRG1 Джин ORF экспрессии кДНК клона плазмидыHG13371-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

LRG1 belongs to the leucine-rich repeat (LRR) family. Members of this family are involved in protein-protein interaction, signal transduction, and cell adhesion and development. LRG1 is expressed during granulocyte differentiation. It contains 4 LIM zinc-binding domains and 1 Rho-GAP domain.

Ссылки
  • O Donnell LC. et al., 2002, J Leukoc Biol. 72 (3): 478-85.
  • Li X. et al., 2007, Neurosci Lett. 413 (2): 141-4.
  • Ramachandran P. et al., 2006, J Proteome Res. 5 (6): 1493-503.
  • Size / Price
    Каталог: HG13371-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».