After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human LOXL3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032603
Размер кДНК:2262bp
Описание кДНК:Full length Clone DNA of Homo sapiens lysyl oxidase-like 3.
Синоним гена:LOXL3, LOXL3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-LOXL3
Участок рестрикции:KpnI + XbaI (6.1kb + 2.26kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12027-ACGRBS16764
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12027-ACRRBS16764
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12027-CFRBS14711
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12027-CHRBS14711
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12027-CMRBS14711
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12027-CYRBS14710
Человек LOXL3 Джин клон кДНК в вектор клонированияHG12027-GRBS5132
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12027-NFRBS14711
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12027-NHRBS14711
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12027-NMRBS14711
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12027-NYRBS14710
Человек LOXL3 Джин ORF экспрессии кДНК клона плазмидыHG12027-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12027-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».