LMNA cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

LMNA cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1995 bp
Description
Full length Clone DNA of Human lamin A/C with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LMNA cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

CDCD1 cDNA ORF Clone, Human; CDDC cDNA ORF Clone, Human; CMD1A cDNA ORF Clone, Human; CMT2B1 cDNA ORF Clone, Human; EMD2 cDNA ORF Clone, Human; FPL cDNA ORF Clone, Human; FPLD cDNA ORF Clone, Human; FPLD2 cDNA ORF Clone, Human; HGPS cDNA ORF Clone, Human; IDC cDNA ORF Clone, Human; LDP1 cDNA ORF Clone, Human; LFP cDNA ORF Clone, Human; LGMD1B cDNA ORF Clone, Human; LMN1 cDNA ORF Clone, Human; LMNC cDNA ORF Clone, Human; LMNL1 cDNA ORF Clone, Human; PRO1 cDNA ORF Clone, Human

LMNA Background Information

Mutations of the LMNA gene encoding the lamin A and C nuclear envelope proteins cause an autosomal dominant form of dilated cardiomyopathy (DCM) with atrioventricular block (AVB). LMNA mutations can also lead to several other disorders, collectively termed laminopathies, involving heart, fat, nerve, bone, and skin tissues, and some premature ageing syndromes.Mutations of the LMNA gene have been shown to cause an autosomal dominant form of insulin resistance with familial partial lipodystrophy (PLD), frequently accompanied by diabetes. LMNA mutations are considered to be a rare cause of monogenic diabetes; however, they are probably sometimes misdiagnosed as type 2 diabetes (T2DM).
Full Name
lamin A/C
Add to Cart Successfully Add to Cart Failed 正在更新购物车,请稍后