Быстрый заказ

Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек LMNA Информация о продукте «Клон cDNA»
    Размер кДНК:1995bp
    Описание кДНК:Full length Clone DNA of Homo sapiens lamin A/C with N terminal Flag tag.
    Синоним гена:HGPS
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with LMNA qPCR primers for gene expression analysis, HP101589 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12058-ACGRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12058-ACRRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12058-ANGRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12058-ANRRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12058-CFRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12058-CHRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12058-CMRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12058-CYRBS14710
    Человек LMNA/lamins A Джин клон кДНК в вектор клонированияHG12058-GRBS5130
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12058-NFRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12058-NHRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12058-NMRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12058-NYRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмидыHG12058-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.