Быстрый заказ

Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек LMNA Информация о продукте «Клон cDNA»
    Размер кДНК:1995bp
    Описание кДНК:Full length Clone DNA of Homo sapiens lamin A/C with C terminal His tag.
    Синоним гена:HGPS
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with LMNA qPCR primers for gene expression analysis, HP101589 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12058-ACGRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12058-ACRRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12058-ANGRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12058-ANRRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12058-CFRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12058-CHRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12058-CMRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12058-CYRBS14710
    Человек LMNA/lamins A Джин клон кДНК в вектор клонированияHG12058-GRBS5130
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12058-NFRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12058-NHRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12058-NMRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12058-NYRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмидыHG12058-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG12058-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.