Быстрый заказ

Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек LMNA Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_170707
    Размер кДНК:1995bp
    Описание кДНК:Full length Clone DNA of Homo sapiens lamin A/C with C terminal HA tag.
    Синоним гена:HGPS
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LMNA qPCR primers for gene expression analysis, HP101589 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12058-ACGRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12058-ACRRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12058-ANGRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12058-ANRRBS16760
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12058-CFRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12058-CHRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12058-CMRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12058-CYRBS14710
    Человек LMNA/lamins A Джин клон кДНК в вектор клонированияHG12058-GRBS5130
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12058-NFRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12058-NHRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12058-NMRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12058-NYRBS14710
    Человек LMNA/lamins A Джин ORF экспрессии кДНК клона плазмидыHG12058-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG12058-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».