After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LIPG Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC060825
Размер кДНК:1503bp
Описание кДНК:Full length Clone DNA of Homo sapiens lipase, endothelial with N terminal Myc tag.
Синоним гена:EL, EDL, PRO719, LIPG
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-LIPG
Участок рестрикции:KpnI + XbaI (6kb + 1.54kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human LIPG Gene Plasmid Map
Human LIPG ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13734-ACGRBS16760
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13734-ACRRBS16760
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13734-CFRBS14710
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13734-CHRBS14710
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13734-CMRBS14710
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13734-CYRBS14710
Человек LIPG Джин клон кДНК в вектор клонированияHG13734-GRBS5130
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13734-NFRBS14710
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13734-NHRBS14710
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13734-NMRBS14710
Человек LIPG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13734-NYRBS14710
Человек LIPG Джин ORF экспрессии кДНК клона плазмидыHG13734-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13734-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human LIPG ORF mammalian expression plasmid, N-Myc tag
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».