Быстрый заказ

Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LILRB2 Информация о продукте «Клон cDNA»
Размер кДНК:1797bp
Описание кДНК:Full length Clone DNA of Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 with C terminal Myc tag.
Синоним гена:ILT4, LIR2, CD85D, LIR-2, MIR10, LILRA6, MIR-10, LILRB2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14132-ACGRBS16760
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14132-ACRRBS16760
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14132-CFRBS14710
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14132-CHRBS14710
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14132-CMRBS14710
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14132-CYRBS14710
Человек LILRB2/ILT4/LIR-2 Джин клон кДНК в вектор клонированияHG14132-GRBS5130
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14132-NFRBS14710
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14132-NHRBS14710
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14132-NMRBS14710
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14132-NYRBS14710
Человек LILRB2/ILT4/LIR-2 Джин ORF экспрессии кДНК клона плазмидыHG14132-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

ILT4, also known as LILRB2, is a member of the the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). ILT4 gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. Multiple transcript variants encoding different isoforms have been found for ILT4 gene. ILT4 is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity.

Size / Price
Каталог: HG14132-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.