Быстрый заказ

Text Size:AAA

Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LIF Информация о продукте «Клон cDNA»
Размер кДНК:609bp
Описание кДНК:Full length Clone DNA of Homo sapiens leukemia inhibitory factor with N terminal Myc tag.
Синоним гена:CDF, DIA, HILDA, MLPLI
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14890-ACGRBS15396
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14890-ACRRBS15396
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14890-CFRBS13343
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14890-CHRBS13343
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14890-CMRBS13343
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14890-CYRBS13343
Человек Leukemia Inhibitory Factor/LIF Джин клон кДНК в вектор клонированияHG14890-GRBS5132
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14890-NFRBS13343
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14890-NHRBS13343
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14890-NMRBS13343
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14890-NYRBS13343
Человек Leukemia Inhibitory Factor/LIF Джин ORF экспрессии кДНК клона плазмидыHG14890-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Leukemia inhibitory factor (LIF) is a pleiotropic glycoprotein belonging to the IL-6 family of cytokines. It’s involved in growth promotion and cell differentiation of different types of target cells, influence on bone metabolism, cachexia, neural development, embryogenesis and inflammation. LIF has potent proinflammatory property, being the inducer of the acute phase protein synthesis and affecting the cell recruitment into the area of damage or inflammation. LIF is also one of the cytokines that are capable to regulate the differentiation of embryonic stem cells, hematopoietic and neuronal cells. LIF binds to the specific LIF receptor (LIFR-α) which forms a heterodimer with a specific subunit common to all members of that family of receptors, the GP130 signal transducing subunit. This leads to activation of the JAK/STAT and MAPK cascades. Due to its polyfunctional activities, LIF is involved in the pathogenic events and development of many diseases of various origin.

  • Salas EM, et al. (2011) LIF, a Novel STAT5-Regulated Gene, Is Aberrantly Expressed in Myeloproliferative Neoplasms. Genes Cancer. 2 (5): 593-6.
  • Chodorowska G, et al. (2004) Leukemia inhibitory factor (LIF) and its biological activity. Ann Univ Mariae Curie Sklodowska Med. 59 (2): 189-93.
  • Garcia-Campana AM, et al. (2007) LIF detection of peptides and proteins in CE. Electrophoresis. 28 (1-2): 208-32.
  • Size / Price
    Каталог: HG14890-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.