Быстрый заказ

Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек LGMN Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC003061
    Размер кДНК:1302bp
    Описание кДНК:Full length Clone DNA of Homo sapiens legumain with N terminal His tag.
    Синоним гена:AEP, LGMN1, PRSC1
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LGMN qPCR primers for gene expression analysis, HP103202 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12846-ACGRBS15400
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12846-ACRRBS15400
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12846-ANGRBS15400
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12846-ANRRBS15400
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12846-CFRBS13340
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12846-CHRBS13340
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12846-CMRBS13340
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12846-CYRBS13340
    Человек Legumain Джин клон кДНК в вектор клонированияHG12846-GRBS5130
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12846-NFRBS13340
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12846-NHRBS13340
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12846-NMRBS13340
    Человек Legumain Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12846-NYRBS13340
    Человек Legumain Джин ORF экспрессии кДНК клона плазмидыHG12846-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The Mammalian Legumain, also known as LGMN, also called asparaginyl endopeptidase (AEP), is a cysteine protease belonging to peptidase family C13 with a strict specificity for hydrolysis of asparaginyl bonds. Known previously only from plants and invertebrates, Legumain is discovered as a lysosomal endopeptidase in mammals. Mammalian Legumain is a cysteine endopeptidase, inhibited by iodoacetamide and maleimides, but unaffected by compound E64. The Mammalian Legumain is involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Legumain has been observed to be highly expressed in several types of solid tumors. It was demonstrated in membrane-associated vesicles concentrated at the invadopodia of tumor cells and on cell surfaces where it colocalized with integrins. Legumain was demonstrated to activate progelatinase A. Cells overexpressing Legumain possessed increased migratory and invasive activity in vitro and adopted an invasive and metastatic phenotype in vivo, inferring significance of Legumain in tumor invasion and metastasis. In addition, Legumain is expressed in both murine and human atherosclerotic lesions. The macrophage-specific expression of Legumain in vivo and ability of Legumain to induce chemotaxis of monocytes and endothelial cells in vitro suggest that Legumain may play a functional role in atherogenesis.

    Ссылки
  • Schwarz G, et al. (2002) Characterization of legumain. Biol Chem. 383(11): 1813-6.
  • Liu C, et al. (2003) Overexpression of legumain in tumors is significant for invasion/metastasis and a candidate enzymatic target for prodrug therapy. Cancer Res. 63(11): 2957-64.
  • Murthy RV, et al. (2005) Legumain expression in relation to clinicopathologic and biological variables in colorectal cancer. Clin Cancer Res. 11(6): 2293-9.
  • Gawenda J, et al. (2007) Legumain expression as a prognostic factor in breast cancer patients. Breast Cancer Res Treat. 102(1): 1-6.
  • Clerin V, et al. (2007) Expression of the cysteine protease legumain in vascular lesions and functional implications in atherogenesis. Atherosclerosis. 201(1): 53-66.
  • Lew?“n S, et al. (2008) A Legumain-based minigene vaccine targets the tumor stroma and suppresses breast cancer growth and angiogenesis. Cancer Immunol Immunother. 57(4): 507-15.
  • Size / Price
    Каталог: HG12846-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».