Быстрый заказ

Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LGALS9 Информация о продукте «Клон cDNA»
Размер кДНК:972bp
Описание кДНК:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 9, transcript variant 2 with C terminal HA tag.
Синоним гена:HUAT, LGALS9A, MGC117375, MGC125973, MGC125974, LGALS9
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11147-ACGRBS15400
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11147-ACRRBS15396
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11147-ANGRBS15396
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11147-ANRRBS15396
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11147-CFRBS13340
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11147-CHRBS13340
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11147-CMRBS13340
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11147-CYRBS13340
Человек Galectin-9/LGALS9 transcript variant 2 Джин клон кДНК в вектор клонированияHG11147-MRBS5132
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11147-M-HRBS13343
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11147-NFRBS13340
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11147-NHRBS13343
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11147-NMRBS13343
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11147-NYRBS13340
Человек Galectin-9/LGALS9 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG11147-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11147-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.