Быстрый заказ

Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек LGALS14 Информация о продукте «Клон cDNA»
    Размер кДНК:420bp
    Описание кДНК:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 14, transcript variant 1 with N terminal His tag.
    Синоним гена:CLC2, PPL13, MGC22235, LGALS14
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with LGALS14 qPCR primers for gene expression analysis, HP101253 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11371-ACGRBS15400
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11371-ACRRBS15400
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11371-ANGRBS15400
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11371-ANRRBS15400
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11371-CFRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11371-CHRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11371-CMRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11371-CYRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин клон кДНК в вектор клонированияHG11371-MRBS5130
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11371-M-FRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11371-NFRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11371-NHRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11371-NMRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11371-NYRBS13340
    Человек Galectin-14/LGALS14 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11371-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG11371-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.