Быстрый заказ

Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LGALS12 Информация о продукте «Клон cDNA»
Размер кДНК:1011bp
Описание кДНК:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 12, transcript variant 2 with C terminal HA tag.
Синоним гена:GRIP1, GALECTIN-12, LGALS12
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11135-ACGRBS15400
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11135-ACRRBS15400
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11135-ANGRBS15400
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11135-ANRRBS15400
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11135-CFRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11135-CHRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11135-CMRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11135-CYRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин клон кДНК в вектор клонированияHG11135-MRBS5130
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11135-M-FRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11135-NFRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11135-NHRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11135-NMRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11135-NYRBS13340
Человек Galectin-12/LGALS12 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG11135-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.