LDOC1 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

LDOC1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
441 bp
Description
Full length Clone DNA of Human leucine zipper, down-regulated in cancer 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LDOC1 cDNA ORF Clone, Human, C-His tag: Alternative Names

42070 cDNA ORF Clone, Human; BCUR1 cDNA ORF Clone, Human; Mart7 cDNA ORF Clone, Human

LDOC1 Background Information

LDOC1 was first identified as a gene encoding a leucine zipper protein whose expression was decreased in a series of pancreatic and gastric cancer cell lines. LDOC1 gene is a known regulator of nuclear factor mediated pathway to apoptosis through inhibition of nuclear factor kappa B (NF-kappaB). Upregulation of LDOC1 in HIBEC increases the expression of NF-kappaB, which may promote the activation of IL-2 and TNF-alpha secretion and inhibit cell apoptosis. The silencing of LDOC1 is a frequent event in cervical cancer and may be of interest as a molecular marker in cervical cancer.
Full Name
leucine zipper, down-regulated in cancer 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait