After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек LDHC Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human LDHC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC064388
Размер кДНК:999bp
Описание кДНК:Full length Clone DNA of Homo sapiens lactate dehydrogenase C DNA.
Синоним гена:CT32, LDH3, LDHX
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15254-ACGRBS15400
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15254-ACRRBS15400
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15254-ANGRBS15400
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15254-ANRRBS15400
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15254-CFRBS13340
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15254-CHRBS13340
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15254-CMRBS13340
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15254-CYRBS13340
Человек LDHC Джин клон кДНК в вектор клонированияHG15254-GRBS5130
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15254-NFRBS13340
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15254-NHRBS13340
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15254-NMRBS13340
Человек LDHC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15254-NYRBS13340
Человек LDHC Джин ORF экспрессии кДНК клона плазмидыHG15254-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15254-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».