LDHA cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

LDHA cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
999 bp
Description
Full length Clone DNA of Human lactate dehydrogenase A.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LDHA cDNA ORF Clone, Human, untagged: Alternative Names

GSD11 cDNA ORF Clone, Human; HEL-S-133P cDNA ORF Clone, Human; LDH1 cDNA ORF Clone, Human; LDHM cDNA ORF Clone, Human; PIG19 cDNA ORF Clone, Human

LDHA Background Information

Lactate dehydrogenase A (LDHA), a key enzyme regulating aerobic glycolysis, is overexpressed in many human cancers, and correlates with poor clinical outcomes.Lactate dehydrogenase-A (LDHA) can promote Warburg effect to produce lactate and Adenosine Triphosphate (ATP) in aerobic condition, which contributes to oncogenesis metastasis and drug resistance in various cancers.Up-regulation of lactate dehydrogenase LDHA, is a frequent event in human malignancies and relate to poor postoperative outcome.
Full Name
lactate dehydrogenase A
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait