After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human LDHA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005566.3
Размер кДНК:999bp
Описание кДНК:Full length Clone DNA of Homo sapiens lactate dehydrogenase A.
Синоним гена:LDH1, LDHM, GSD11, PIG19, HEL-S-133P
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16141-ACGRBS15400
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16141-ACRRBS15400
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16141-ANGRBS15400
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16141-ANRRBS15400
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16141-CFRBS13340
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16141-CHRBS13340
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16141-CMRBS13340
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16141-CYRBS13340
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16141-NFRBS13340
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16141-NHRBS13340
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16141-NMRBS13340
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16141-NYRBS13340
Человек LDH-A / LDHA Джин клон кДНК в вектор клонированияHG16141-URBS5130
Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмидыHG16141-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16141-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».