Быстрый заказ

Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек LDHA Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005566.3
    Размер кДНК:999bp
    Описание кДНК:Full length Clone DNA of Homo sapiens lactate dehydrogenase A.
    Синоним гена:LDH1, LDHM, GSD11, PIG19, HEL-S-133P
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LDHA qPCR primers for gene expression analysis, HP100007 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16141-ACGRBS15400
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16141-ACRRBS15400
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16141-ANGRBS15400
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16141-ANRRBS15400
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16141-CFRBS13340
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16141-CHRBS13340
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16141-CMRBS13340
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16141-CYRBS13340
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16141-NFRBS13340
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16141-NHRBS13340
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16141-NMRBS13340
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16141-NYRBS13340
    Человек LDH-A / LDHA Джин клон кДНК в вектор клонированияHG16141-URBS5130
    Человек LDH-A / LDHA Джин ORF экспрессии кДНК клона плазмидыHG16141-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG16141-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».