After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LCP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005565.3
Размер кДНК:1602bp
Описание кДНК:Full length Clone DNA of Homo sapiens lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) with N terminal Flag tag.
Синоним гена:SLP76, SLP-76, LCP2
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11237-ACGRBS16760
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11237-ACRRBS16760
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11237-ANGRBS16760
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11237-ANRRBS16760
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11237-CFRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11237-CHRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11237-CMRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11237-CYRBS14710
Человек LCP2/SLP-76 Джин клон кДНК в вектор клонированияHG11237-MRBS5130
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11237-M-FRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмидыHG11237-M-NRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11237-NFRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11237-NHRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11237-NMRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11237-NYRBS14710
Человек LCP2/SLP-76 Джин ORF экспрессии кДНК клона плазмидыHG11237-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».