After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LBP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004139.2
Размер кДНК:1446bp
Описание кДНК:Full length Clone DNA of Homo sapiens lipopolysaccharide binding protein with N terminal HA tag.
Синоним гена:MGC22233
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10526-ACGRBS15400
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10526-ACRRBS15400
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10526-CFRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10526-CHRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10526-CMRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10526-CYRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин клон кДНК в вектор клонированияHG10526-MRBS5130
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10526-M-FRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10526-NFRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10526-NHRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10526-NMRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10526-NYRBS13340
Человек Lipopolysaccharide binding Белок/LBP Джин ORF экспрессии кДНК клона плазмидыHG10526-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Lipopolysaccharide binding protein ( LBP ) is a glycoprotein that is synthesized principally by hepatocytes. LBP is a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides ( LPSs ). LBP binds directly to the outer membrane of Gram-negative bacteria and to purified aggregates of extracted endotoxin, and catalyses the delivery of endotoxin to membrane ( mCD14,GPI-Linked ) and soluble ( sCD14 ) forms of CD14, thereby markedly increasing host cell sensitivity to endotoxin. LBP efficiently catalyses the transfer of individual molecules of endotoxin to (s)CD14 only when LBP–endotoxin aggregates are formed in the presence of albumin. In the presence of EDTA, LBP binding promotes further disaggregation of endotoxin. LBP binding does not have such drastic effects under more physiological conditions, but may still induce more subtle topological rearrangements of endotoxin.

Ссылки
  • J. Weiss, 2003, Biochemical Society Transactions: Volume 31, part 4: 785-790.
  • RR Schumann, et al., Science, 1990, Vol 249, Issue 4975: 1429-143.
  • Carsten J. Kirschning, et al., 1997, Genomics, Volume 46, Issue 3: 416-25.
  • Size / Price
    Каталог: HG10526-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».