Быстрый заказ

Text Size:AAA

Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LAPTM4A Информация о продукте «Клон cDNA»
Размер кДНК:702bp
Описание кДНК:Full length Clone DNA of Homo sapiens lysosomal protein transmembrane 4 alpha with C terminal HA tag.
Синоним гена:MBNT, Mtrp, LAPTM4, HUMORF13
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16391-ACGRBS15400
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16391-ACRRBS15400
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16391-CFRBS13340
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16391-CHRBS13340
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16391-CMRBS13340
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16391-CYRBS13340
Человек LAPTM4A Джин клон кДНК в вектор клонированияHG16391-GRBS5130
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16391-NFRBS13340
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16391-NHRBS13340
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16391-NMRBS13340
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16391-NYRBS13340
Человек LAPTM4A Джин ORF экспрессии кДНК клона плазмидыHG16391-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16391-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.