Быстрый заказ

Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human L3MBTL4 Информация о продукте «Клон cDNA»
Размер кДНК:1605bp
Описание кДНК:Full length Clone DNA of Homo sapiens l(3)mbt-like 4 (Drosophila) with N terminal His tag.
Синоним гена:HsT1031
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14847-ACGRBS16760
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14847-ACRRBS16760
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14847-ANGRBS16760
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14847-ANRRBS16760
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14847-CFRBS14710
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14847-CHRBS14710
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14847-CMRBS14710
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14847-CYRBS14710
Человек L3MBTL4 Джин клон кДНК в вектор клонированияHG14847-GRBS5130
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14847-NFRBS14710
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14847-NHRBS14710
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14847-NMRBS14710
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14847-NYRBS14710
Человек L3MBTL4 Джин ORF экспрессии кДНК клона плазмидыHG14847-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14847-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.