Быстрый заказ

Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек L3MBTL3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC060845
    Размер кДНК:2268bp
    Описание кДНК:Full length Clone DNA of Homo sapiens l(3)mbt-like 3 (Drosophila) DNA.
    Синоним гена:MBT1, MBT-1, RP11-73O6.1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with L3MBTL3 qPCR primers for gene expression analysis, HP103857 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15231-ACGRBS16760
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15231-ACRRBS16760
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15231-ANGRBS16760
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15231-ANRRBS16760
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15231-CFRBS14710
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15231-CHRBS14710
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15231-CMRBS14710
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15231-CYRBS14710
    Человек L3MBTL3 Джин клон кДНК в вектор клонированияHG15231-GRBS5130
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15231-NFRBS14710
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15231-NHRBS14710
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15231-NMRBS14710
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15231-NYRBS14710
    Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмидыHG15231-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15231-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».