After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human L3MBTL3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC060845
Размер кДНК:2268bp
Описание кДНК:Full length Clone DNA of Homo sapiens l(3)mbt-like 3 (Drosophila) DNA.
Синоним гена:MBT1, MBT-1, RP11-73O6.1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15231-ACGRBS16760
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15231-ACRRBS16760
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15231-ANGRBS16760
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15231-ANRRBS16760
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15231-CFRBS14710
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15231-CHRBS14710
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15231-CMRBS14710
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15231-CYRBS14710
Человек L3MBTL3 Джин клон кДНК в вектор клонированияHG15231-GRBS5130
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15231-NFRBS14710
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15231-NHRBS14710
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15231-NMRBS14710
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15231-NYRBS14710
Человек L3MBTL3 Джин ORF экспрессии кДНК клона плазмидыHG15231-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».