Быстрый заказ

Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KXD1 Информация о продукте «Клон cDNA»
Размер кДНК:531bp
Описание кДНК:Full length Clone DNA of Homo sapiens KxDL motif containing 1 with C terminal HA tag.
Синоним гена:KXDL, MST096, MSTP096, C19orf50
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16369-ACGRBS15400
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16369-ACRRBS15400
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16369-ANGRBS15400
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16369-ANRRBS15400
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16369-CFRBS13340
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16369-CHRBS13340
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16369-CMRBS13340
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16369-CYRBS13340
Человек KXD1/C19orf50 Джин клон кДНК в вектор клонированияHG16369-GRBS5130
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16369-NFRBS13340
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16369-NHRBS13340
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16369-NMRBS13340
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16369-NYRBS13340
Человек KXD1/C19orf50 Джин ORF экспрессии кДНК клона плазмидыHG16369-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16369-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.