After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KLRK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007360.2
Размер кДНК:651bp
Описание кДНК:Full length Clone DNA of Homo sapiens killer cell lectin-like receptor subfamily K, member 1 with C terminal Myc tag.
Синоним гена:KLR, CD314, NKG2D, NKG2-D, FLJ17759, FLJ75772, D12S2489E
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10575-ACGRBS15400
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10575-ACRRBS15400
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10575-CFRBS13340
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10575-CHRBS13340
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10575-CMRBS13340
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10575-CYRBS13340
Человек NKG2D/CD314/KLRK1 Джин клон кДНК в вектор клонированияHG10575-MRBS5130
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10575-NFRBS13340
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10575-NHRBS13340
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10575-NMRBS13340
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10575-NYRBS13340
Человек NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмидыHG10575-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NKG2D, also known as CD314, is an immune receptor which consists of two disulphide-linked type II transmembrane proteins with short intracellular proteins uncapable to transduce signals. In order to transduce signals, NKG2D needs adaptor proteins and it uses two adaptor proteins, DAP10 and DAP12. These two adaptor proteins associate as homodimers to NKG2D- therefore the entire receptor complex appears as a hexamer. NKG2D can send co-stimulatory signals to activate CD8 T cells. NKG2D also plays an important role in viral control. Cellular stress can induce ligands for NKG2D which results in the cell susceptible to NK cell-mediated lysis.

Ссылки
  • Houchins J, et al. (1991) DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med. 173: 1017-102.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428):727-9.
  • Zafirova B, et al. (2011) Regulation of immune cell function and differentiation by the NKG2D receptor. Cell Mol Life Sci. 68(21):3519-29.
  • Size / Price
    Каталог: HG10575-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».