Быстрый заказ

Text Size:AAA

Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KIRREL Информация о продукте «Клон cDNA»
Размер кДНК:2274bp
Описание кДНК:Full length Clone DNA of Homo sapiens kin of IRRE like (Drosophila) with C terminal His tag.
Синоним гена:NEPH1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15752-ACGRBS16760
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15752-ACRRBS16760
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15752-CFRBS14710
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15752-CHRBS14710
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15752-CMRBS14710
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15752-CYRBS14710
Человек KIRREL1/NEPH1 Джин клон кДНК в вектор клонированияHG15752-GRBS5130
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15752-NFRBS14710
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15752-NHRBS14710
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15752-NMRBS14710
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15752-NYRBS14710
Человек KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмидыHG15752-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

NEPH1 (KIRREL1) belongs to a family of three closely related transmembrane proteins of the Ig superfamily with a structure similar to that of nephrin. All three Neph proteins share a conserved podocin-binding motif; mutation of a centrally located tyrosine residue dramatically lowers the affinity of Neph1 for podocin. Neph1 triggers AP-1 activation similarly to nephrin but requires the presence of Tec family kinases for efficient transactivation. Neph1 consists of a signal peptide, five Ig-like C2-type domains with the middle domain overlapping with a PKD-like domain, an RGD sequence, a transmembrane domain and a cytoplasmic tail, which is expressed in slit diaphragm domains of podocytes and in vertebrate and invertebrate nervous systems. Neph1 is abundantly expressed in the kidney, specifically expressed in podocytes of kidney glomeruli, and plays a significant role in the normal development and function of the glomerular permeability. Neph1 interacts with nephrin in vitro and in vivo, and able to stimulate transcriptional activation in a model system, such as the activation the transcription factor AP-1 via the stimulation of a MAPK module. Neph1 is crucial for the integrity of the slit diaphragm, as Neph1 gene knockout mice results in effacement of glomerular podocytes, heavy proteinuria, and early postnatal death.

  • Sellin L, et al. (2003) NEPH1 defines a novel family of podocin interacting proteins. FASEB J. 17(1): 115-7.
  • Kim EY, et al. (2009) Neph1 regulates steady-state surface expression of Slo1 Ca(2+)-activated K(+) channels: different effects in embryonic neurons and podocytes. Am J Physiol Cell Physiol. 297(6): C1379-88.
  • Size / Price
    Каталог: HG15752-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.