Быстрый заказ

Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KIR2DL3 Информация о продукте «Клон cDNA»
Размер кДНК:1026bp
Описание кДНК:Full length Clone DNA of Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 with N terminal His tag.
Синоним гена:p58, NKAT, GL183, NKAT2, CD158b, NKAT2A, NKAT2B, CD158B2, KIR-K7b, KIR-K7c, KIRCL23, KIR-023GB
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12828-ACGRBS15400
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12828-ACRRBS15400
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12828-CFRBS13340
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12828-CHRBS13340
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12828-CMRBS13340
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12828-CYRBS13340
Человек KIR2DL3 (CD158b2) Джин клон кДНК в вектор клонированияHG12828-GRBS5130
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12828-NFRBS13340
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12828-NHRBS13340
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12828-NMRBS13340
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12828-NYRBS13340
Человек KIR2DL3 (CD158b2) Джин ORF экспрессии кДНК клона плазмидыHG12828-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Killer cell immunoglobulin-like receptor 2DL3, also known as CD158 antigen-like family member B2, KIR-023GB, Killer inhibitory receptor cl 2-3, MHC class I NK cell receptor, NKAT2a, NKAT2b, Natural killer-associated transcript 2, p58 natural killer cell receptor clone CL-6, p58.2 MHC class-I-specific NK receptor, CD158b2 and KIR2DL3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. KIR2DL3 contains 2 Ig-like C2-type (immunoglobulin-like) domains. KIR2DL3 interacts with ARRB2. KIR2DL3 is a receptor on natural killer (NK) cells for HLA-C alleles (HLA-Cw1, HLA-Cw3 and HLA-Cw7). KIR2DL3 inhibits the activity of NK cells thus preventing cell lysis.

  • Selvakumar A., et al., 1997, Immunol. Rev. 155:183-196.
  • Wilson M.J., et al., 1997, Tissue Antigens 49:574-579.
  • Maenaka K., et al., 1999, Structure 7:391-398.
  • Vitale,M. et al., 2004, Int Immunol. 16 (10):1459-66.
  • Yu M.-C., et al., 2008, Nat. Immunol. 9:898-907.
  • Size / Price
    Каталог: HG12828-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.