After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KIFC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC121041
Размер кДНК:2022bp
Описание кДНК:Full length Clone DNA of Homo sapiens kinesin family member C1 with N terminal His tag.
Синоним гена:HSET, KNSL2
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
????��??????3?o?MG53720???������?o��?????o?????????��?����??���䡧?2??????�㨨���?1????������?��????????��????����騨���???
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15958-ACGRBS16760
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15958-ACRRBS16760
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15958-ANGRBS16760
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15958-ANRRBS16760
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15958-CFRBS14710
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15958-CHRBS14710
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15958-CMRBS14710
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15958-CYRBS14710
Человек KIFC1 Джин клон кДНК в вектор клонированияHG15958-GRBS5130
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15958-NFRBS14710
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15958-NHRBS14710
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15958-NMRBS14710
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15958-NYRBS14710
Человек KIFC1 Джин ORF экспрессии кДНК клона плазмидыHG15958-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».