KIF3A cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

KIF3A cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2109 bp
Description
Full length Clone DNA of Human kinesin family member 3A.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KIF3A cDNA ORF Clone, Human, untagged: Alternative Names

FLA10 cDNA ORF Clone, Human; KLP-20 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed