After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human KIF3A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC045542
Размер кДНК:2109bp
Описание кДНК:Full length Clone DNA of Homo sapiens kinesin family member 3A.
Синоним гена:FLA10, KLP-20
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15200-ACGRBS16764
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15200-ACRRBS16760
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15200-ANGRBS16764
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15200-ANRRBS16760
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15200-CFRBS14711
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15200-CHRBS14711
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15200-CMRBS14711
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15200-CYRBS14711
Человек KIF3A Джин клон кДНК в вектор клонированияHG15200-GRBS5132
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15200-NFRBS14711
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15200-NHRBS14711
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15200-NMRBS14711
Человек KIF3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15200-NYRBS14711
Человек KIF3A Джин ORF экспрессии кДНК клона плазмидыHG15200-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15200-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».